|
OriGene
origene provided primer sequences Origene Provided Primer Sequences, supplied by OriGene, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+sequences/Primer/pmc13655222-87-0-0 Average 97 stars, based on 1 article reviews
origene provided primer sequences - by Bioz Stars,
2026-10
97/100 stars
|
Buy from Supplier |
|
OriGene
human qpcr primer sequences Human Qpcr Primer Sequences, supplied by OriGene, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+sequences/Primer/pm42854358-96-1-12 Average 97 stars, based on 1 article reviews
human qpcr primer sequences - by Bioz Stars,
2026-10
97/100 stars
|
Buy from Supplier |
|
OriGene
rt qpcr primer sequence source ctrr3 for cggcctctccttctgtatgc Rt Qpcr Primer Sequence Source Ctrr3 For Cggcctctccttctgtatgc, supplied by OriGene, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+sequences/Primer/pm42816552-656-14-34 Average 97 stars, based on 1 article reviews
rt qpcr primer sequence source ctrr3 for cggcctctccttctgtatgc - by Bioz Stars,
2026-10
97/100 stars
|
Buy from Supplier |
|
Complete Genomics Inc
high throughput sequencing High Throughput Sequencing, supplied by Complete Genomics Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+sequences/High-throughput+Sequencing+Primer+Kit/pmc13638532-94-0-14 Average 99 stars, based on 1 article reviews
high throughput sequencing - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
|
Illumina Inc
illumina truseq primers Illumina Truseq Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+sequences/TruSeq+Dual+Index+Sequencing+Primer+Box/pmc13635221-440-12-12 Average 96 stars, based on 1 article reviews
illumina truseq primers - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
Plasmidsaurus
primer free whole plasmid sequencing by plasmidosaurus Primer Free Whole Plasmid Sequencing By Plasmidosaurus, supplied by Plasmidsaurus, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+sequences/Plasmid/pmc13553963-124-5-9 Average 99 stars, based on 1 article reviews
primer free whole plasmid sequencing by plasmidosaurus - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
|
Sangon Biotech
primer sequences Primer Sequences, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+sequences/primer+sequences/pmc13196531-228-1-9 Average 86 stars, based on 1 article reviews
primer sequences - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
OriGene
primer sequences Primer Sequences, supplied by OriGene, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+sequences/Primer/10__1016_slash_j__jpha__2026__101746-241-0-7 Average 97 stars, based on 1 article reviews
primer sequences - by Bioz Stars,
2026-10
97/100 stars
|
Buy from Supplier |
|
Complete Genomics Inc
paired end sequencing primer kit Paired End Sequencing Primer Kit, supplied by Complete Genomics Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+sequences/High-throughput+Sequencing+Primer+Kit/10__1016_slash_j__cej__2026__179985-97-20-25 Average 99 stars, based on 1 article reviews
paired end sequencing primer kit - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |